Wishlist Quick view Allen-Bradley Allen-Bradley 440T-MKEXE36TPTMTMTMTMTMTMTMTMTMTMTMTMTMTMTMTMTMTMTMTM - 440T Exchange Unit €6,087.00 Exchange Unit, Standard Key Code Labeling, 1 key in 20 keys outOPERATIONInfo for Exchange UnitThe key exchange unit (KEX) is used in an interlocking sequence to link together other devices in the Prosafe range and caters to more complex operating... Add to Wishlist
Wishlist Quick view Allen-Bradley Allen-Bradley 440T-MKEXE370A0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B - 440T Exchange Unit €6,378.00 Exchange Unit, Standard Key Code Labeling, 1 key in 21 keys outOPERATIONInfo for Exchange UnitThe key exchange unit (KEX) is used in an interlocking sequence to link together other devices in the Prosafe range and caters to more complex operating... Add to Wishlist
Wishlist Quick view Allen-Bradley Allen-Bradley 440T-MKEXE36GCGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA - 440T Exchange Unit €6,087.00 Exchange Unit, Standard Key Code Labeling, 1 key in 20 keys outOPERATIONInfo for Exchange UnitThe key exchange unit (KEX) is used in an interlocking sequence to link together other devices in the Prosafe range and caters to more complex operating... Add to Wishlist
Wishlist Quick view Allen-Bradley Allen-Bradley 440T-MKEXE36SLSMSMSMSMSMSMSMSMSMSMSMSMSMSMSMSMSMSMSMSM - 440T Exchange Unit €6,087.00 Exchange Unit, Standard Key Code Labeling, 1 key in 20 keys outOPERATIONInfo for Exchange UnitThe key exchange unit (KEX) is used in an interlocking sequence to link together other devices in the Prosafe range and caters to more complex operating... Add to Wishlist
Wishlist Quick view Allen-Bradley Allen-Bradley 440T-MKEXE36PDPMPMPMPMPMPMPMPMPMPMPMPMPMPMPMPMPMPMPMPM - 440T Exchange Unit €6,087.00 Exchange Unit, Standard Key Code Labeling, 1 key in 20 keys outOPERATIONInfo for Exchange UnitThe key exchange unit (KEX) is used in an interlocking sequence to link together other devices in the Prosafe range and caters to more complex operating... Add to Wishlist
Wishlist Quick view Allen-Bradley Allen-Bradley 440T-MKEXE36KHOAOBOCODOEOFOGOHOIOJOKOLOMONOOOPOROSOTOU - 440T Exchange Unit €6,087.00 Exchange Unit, Standard Key Code Labeling, 1 key in 20 keys outOPERATIONInfo for Exchange UnitThe key exchange unit (KEX) is used in an interlocking sequence to link together other devices in the Prosafe range and caters to more complex operating... Add to Wishlist
Wishlist Quick view Allen-Bradley Allen-Bradley 440T-MKEXE36CDCMCMCMCMCMCMCMCMCMCMCMCMCMCMCMCMCMCMCMCM - 440T Exchange Unit €6,087.00 Exchange Unit, Standard Key Code Labeling, 1 key in 20 keys outOPERATIONInfo for Exchange UnitThe key exchange unit (KEX) is used in an interlocking sequence to link together other devices in the Prosafe range and caters to more complex operating... Add to Wishlist
Wishlist Quick view Allen-Bradley Allen-Bradley 440T-MKEXE36GAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHA - 440T Exchange Unit €6,087.00 Exchange Unit, Standard Key Code Labeling, 1 key in 20 keys outOPERATIONInfo for Exchange UnitThe key exchange unit (KEX) is used in an interlocking sequence to link together other devices in the Prosafe range and caters to more complex operating... Add to Wishlist
Wishlist Quick view Allen-Bradley Allen-Bradley 440T-MKEXE36ACADADADADADADADADDADADADADADADADADADADADA - 440T Exchange Unit €6,087.00 Exchange Unit, Standard Key Code Labeling, 1 key in 20 keys outOPERATIONInfo for Exchange UnitThe key exchange unit (KEX) is used in an interlocking sequence to link together other devices in the Prosafe range and caters to more complex operating... Add to Wishlist
Wishlist Quick view Allen-Bradley Allen-Bradley 440T-MKEXE36AABABABABABABABABABABABABABABABABABABABABA - 440T Exchange Unit €6,087.00 Exchange Unit, Standard Key Code Labeling, 1 key in 20 keys outOPERATIONInfo for Exchange UnitThe key exchange unit (KEX) is used in an interlocking sequence to link together other devices in the Prosafe range and caters to more complex operating... Add to Wishlist
Wishlist Quick view Allen-Bradley Allen-Bradley 440T-MKEXE363DAA3DAB3DAB3DAB3DAB3DAB3DAB3DAB3DAB3DAB3DAB3DAB3DAB3DAB3DAB3DAB3DAB3DAB3DAB3DAB3DAB - 440T Exchange Unit €6,087.00 Exchange Unit, Standard Key Code Labeling, 1 key in 20 keys outOPERATIONInfo for Exchange UnitThe key exchange unit (KEX) is used in an interlocking sequence to link together other devices in the Prosafe range and caters to more complex operating... Add to Wishlist
Wishlist Quick view Allen-Bradley Allen-Bradley 440T-MKEXE36AAABABABABABABABABABABABABABABABABABABABAB - 440T Exchange Unit €6,087.00 Exchange Unit, Standard Key Code Labeling, 1 key in 20 keys outOPERATIONInfo for Exchange UnitThe key exchange unit (KEX) is used in an interlocking sequence to link together other devices in the Prosafe range and caters to more complex operating... Add to Wishlist
Wishlist Quick view Allen-Bradley Allen-Bradley 440T-MKEXE360SSASASASASASASASASASASASASASASASASASASASA - 440T Exchange Unit €6,087.00 Exchange Unit, Standard Key Code Labeling, 1 key in 20 keys outOPERATIONInfo for Exchange UnitThe key exchange unit (KEX) is used in an interlocking sequence to link together other devices in the Prosafe range and caters to more complex operating... Add to Wishlist
Wishlist Quick view Allen-Bradley Allen-Bradley 440T-MKEXE360Y0E0F0G0H0I0J0K0L0M0N0O0P0R0S0T0U0V0X0W0Z - 440T Exchange Unit €6,087.00 Exchange Unit, Standard Key Code Labeling, 1 key in 20 keys outOPERATIONInfo for Exchange UnitThe key exchange unit (KEX) is used in an interlocking sequence to link together other devices in the Prosafe range and caters to more complex operating... Add to Wishlist
Wishlist Quick view Allen-Bradley Allen-Bradley 440T-MKEXE360MMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMAMA - 440T Exchange Unit €6,087.00 Exchange Unit, Standard Key Code Labeling, 1 key in 20 keys outOPERATIONInfo for Exchange UnitThe key exchange unit (KEX) is used in an interlocking sequence to link together other devices in the Prosafe range and caters to more complex operating... Add to Wishlist
Wishlist Quick view Allen-Bradley Allen-Bradley 440T-MKEXE360A0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B0B - 440T Exchange Unit €6,087.00 Exchange Unit, Standard Key Code Labeling, 1 key in 20 keys outOPERATIONInfo for Exchange UnitThe key exchange unit (KEX) is used in an interlocking sequence to link together other devices in the Prosafe range and caters to more complex operating... Add to Wishlist