Allen-Bradley
Allen-Bradley 440T-MKEXE36GCGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA - 440T Exchange Unit
- SKU:
- 440T-MKEXE36GCGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
4 Great reasons to buy from us:
| OPERATION | |
|---|---|
| Info for Exchange Unit | The key exchange unit (KEX) is used in an interlocking sequence to link together other devices in the Prosafe range and caters to more complex operating sequences. The operating principle is such that no secondary keys can be removed from the unit until all primary keys have been inserted, rotated, and trapped. The primary keys remain trapped until all secondary keys have been re-inserted, rotated, and trapped. It is typically used in applications where there is more than one access way to the hazardous area, and each access way must be open at the same time. The key exchange unit accomplishes this by allowing one or more keys to be inserted which then releases multiple keys out. A typical process may require a rotary key switch to turn a motor off. The key from the rotary switch is removed and inserted into a KEX. The KEX then releases three keys which would allow simultaneous access to the hazard area through three different gates. This KEX is described as 1 key in 3 keys out. The keys in are considered primary codes, so the keys are not included in the KEX. The keys out are considered secondary codes, so the keys are included Key Exchange Units have a range of standard units in various combinations and incorporate Primary keys in release secondary keys simultaneously on units up to six ways and Replaceable code barrel assemblies |
| EXCHANGE UNIT DATA | |
|---|---|
| Key Code Labeling | Standard Key Code Labeling |
| Number Of Keys | 21 way |
| Keys In And Out | 1 key in 20 keys out |
| CODE DATA | |
|---|---|
| Would you like help entering codes? | No |
| Please Wait | Note that when filling out keycodes for exchange units with large number of keys, the verification process can take up to 60 seconds after entering in a keycode. Please be patient. |
| Key 1 Code | Gc |
| Key 2 Code | Ga Secondary Key 1 |
| Key 3 Code | Ga |
| Key 4 Code | Ga |
| Key 5 Code | Ga |
| Key 6 Code | Ga |
| Key 7 Code | Ga |
| Key 8 Code | Ga |
| Key 9 Code | Ga |
| Key 10 Code | Ga |
| Key 11 Code | Ga |
| Key 12 Code | Ga |
| Key 13 Code | Ga |
| Key 14 Code | Ga |
| Key 15 Code | Ga |
| Key 16 Code | Ga |
| Key 17 Code | Ga |
| Key 18 Code | Ga |
| Key 19 Code | Ga |
| Key 20 Code | Ga |
| Key 21 Code | Ga |
To edit this page simply login to the control panel, click the Website Content tab and choose the View Web Pages option. Click Edit next to the Shipping & Returns page and you can change this text. A sample returns policy is shown below which you can edit as needed.
Returns Policy
You may return most new, unopened items within 30 days of delivery for a full refund. We'll also pay the return shipping costs if the return is a result of our error (you received an incorrect or defective item, etc.).
You should expect to receive your refund within four weeks of giving your package to the return shipper, however, in many cases you will receive a refund more quickly. This time period includes the transit time for us to receive your return from the shipper (5 to 10 business days), the time it takes us to process your return once we receive it (3 to 5 business days), and the time it takes your bank to process our refund request (5 to 10 business days).
If you need to return an item, simply login to your account, view the order using the "Complete Orders" link under the My Account menu and click the Return Item(s) button. We'll notify you via e-mail of your refund once we've received and processed the returned item.
Shipping
We can ship to virtually any address in the world. Note that there are restrictions on some products, and some products cannot be shipped to international destinations.
When you place an order, we will estimate shipping and delivery dates for you based on the availability of your items and the shipping options you choose. Depending on the shipping provider you choose, shipping date estimates may appear on the shipping quotes page.
Please also note that the shipping rates for many items we sell are weight-based. The weight of any such item can be found on its detail page. To reflect the policies of the shipping companies we use, all weights will be rounded up to the next full pound.
Integer et est tellus non bibendum est. Namcos tempus turpis at metus scelerisque placerat nulla eu sollicitudin felis. Pellentesque diam dolor elementum et lobortis at mollis ut risus. Sed faucibus ullamcorper mattis. Fusce molestie elit a loremos tempus scelerisque blandit tortor cursus. Quisque dolutpat orci ut metus malesuada lorem in interdum lectus scelerisque. Praesent eu odio ut nisi ullamcorper ultricies. Cum sociis natoque penatibus et magnis dis parturient montes, nascetur ridiculus mus.
Praesent at justo congue leo adipiscing
- Integer et est tellusInteger et est tellus non bibendum est.
- Namcos tempusNamcos tempus turpis at metus scelerisque placerat nulla eu sollicitudin felis.
- Pellentesque diam dolorPellentesque diam dolor elementum et lobortis at mollis ut risus.
- Sed faucibusSed faucibus ullamcorper mattis.
- Fusce molestie elitosFusce molestie elit a loremos tempus scelerisque blandit tortor cursus.
- Quisque dolutpat orcisQuisque dolutpat orci ut metus malesuada lorem in interdum lectus scelerisque.
- Praesent an modioPraesent eu odio ut nisi ullamcorper ultricies.
- Cum sociis natoque penatibusCum sociis natoque penatibus et magnis dis parturient montes, nascetur ridiculus mus.




